WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

Pages:   || 2 |

Молекулярно-генетические методы и компьютерные технологии в системе эпидемиологического надзора за хантавирусными инфекциями

-- [ Страница 1 ] --

На правах рукописи






ГАРАНИНА Светлана Борисовна




МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ МЕТОДЫ И КОМПЬЮТЕРНЫЕ ТЕХНОЛОГИИ В СИСТЕМЕ ЭПИДЕМИОЛОГИЧЕСКОГО НАДЗОРА

ЗА ХАНТАВИРУСНЫМИ ИНФЕКЦИЯМИ




14.00.30 – эпидемиология

03.00.06 - вирусология


АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора биологических наук

Москва - 2009

Работа выполнена в Федеральном государственном учреждении науки «Центральный НИИ эпидемиологии» Роспотребнадзора.

Научные консультанты:

Доктор биологических наук Платонов Александр Евгеньевич

Член-корреспондент РАМН,

доктор медицинских наук, профессор Кутырев Владимир Викторович


Официальные оппоненты:

Доктор медицинских наук, профессор Ющенко Галина Васильевна

Заслуженный деятель науки РФ,

доктор медицинских наук, профессор Самойлова Любовь Владимировна

Член-корреспондент РАМН,

доктор медицинских наук, профессор Урываев Леонид Викторович

Ведущая организация: Государственное учреждение Институт полиомиелита и вирусных энцефалитов им. М.П. Чумакова РАМН.

Защита диссертации состоится «_____» _______________ 2009 г. в 11 часов на заседании диссертационного совета Д 001.007.02 в Государственном учреждении научно-исследовательском Институте эпидемиологии и микробиологии им. Н.Ф. Гамалеи РАМН по адресу:123098, г. Москва, ул. Гамалеи, д.18.

С диссертацией можно ознакомиться в библиотеке ГУ НИИ эпидемиологии и микробиологии им. Н.Ф. Гамалеи РАМН

Автореферат диссертации разослан "______" ________________________ 2009 г.

Ученый секретарь диссертационного совета

доктор медицинских наук, профессор Русакова Екатерина Владимировна

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Геморрагическая лихорадка с почечным синдромом (ГЛПС) является одним из наиболее распространенных вирусных, природно-очаговых инфекционных заболеваний человека на территории Российской Федерации. Этиологическими агентами ГЛПС являются хантавирусы - представители семейства Bunyaviridae, рода Hantavirus.

Официальная регистрация заболеваемости в стране введена в 1978 году. Начиная с этого времени и по 2007 г. было зарегистрировано более 184 тысяч случаев ГЛПС в 71 из 83 субъектов РФ. В последние годы отмечается высокая эпизоотическая активность природных очагов хантавирусов, при этом постоянно сохраняется потенциальная опасность заражения людей, находящихся на эндемичных территориях. В настоящее время на территории РФ выявлена циркуляция хантавирусов - Пуумала, Добрава, Хантаан, Сеул, Амур, Тула, Топографов и Хабаровск, которые определяют существование эндемичных природных очагов ГЛПС (Р.А. Слонова с соавт. 1996; Е.А. Ткаченко, С.Г. Дроздов 2002; Л.И. Иванов с соавт. 2003). Установлено, что динамика и интенсивность эпидемических проявлений ГЛПС, различная степень тяжести заболеваний и уровень летальности тесно связаны с инфицированием определенными гено-(серо) типами хантавирусов (Е.В. Лещинская с соавт. 1990).

Известно, что природными резервуарами хантавирусов и источниками заражения людей являются мышевидные грызуны. В отличие от других вирусов семейства Bunyaviridae хантавирусы не передаются членистоногими, инфицирование людей происходит преимущественно при контакте с выделениями зараженных грызунов (Е.А. Ткаченко с соавт. 2001).

Отсутствие тенденции к снижению заболеваемости ГЛПС, расширение ареала инфекции, участившиеся случаи возникновения непрогнозируемых вспышек ГЛПС, ассоциированных с новыми хантавирусами, свидетельствуют о несовершенстве действующей системы эпидемиологического надзора.

Слежение за эпизоотическим процессом является одним из основных компонентов эпиднадзора за ГЛПС. Своевременное выявление важных критериев напряжённости эпизоотического процесса, таких как численность грызунов, индексы доминирования основных носителей, уровень их инфицированности и т.д., нацелено на своевременное прогнозирование осложнения эпидситуации. Однако традиционно используемые методы в эпизоотологических исследованиях не позволяют оценить спектр циркулирующих вирусов, определить перечень их основных носителей, что снижает эффективность противоэпидемических мероприятий в целом. Знания об особенностях природных очагов, приуроченных к различным ландшафтно-географическим зонам, позволяют своевременно выявлять предвестники эпизоотической активности очагов и правильно определять тактику профилактических мероприятий (А.Д. Бернштейн с соавт. 2004).

Преимущества молекулярно-генетических методов в отношении диагностики (детекции, идентификации) хантавирусов приобретают особую значимость в связи с существующими трудностями при размножении этих вирусов в клеточных культурах и отсутствием удачной лабораторной модели инфекции. ПЦР является практически единственным методом, позволяющим дать прямое доказательство наличия хантавирусов в различных биологических материалах, полученных как от человека, так и от животных (А.Е. Деконенко, Е.А. Ткаченко 2004). Беспрецедентным в вирусологии является выделение 9-ти самостоятельных видов хантавирусов (Bayou, Laguna Negra, Isla Vista, Rio Mamore и др.), циркулирующих на Американском континенте, только на основании данных о нуклеотидных сиквенсах их геномов, без изоляции вирусной культуры (A. Plyusnin 2002).

Эпидемический процесс при ГЛПС чрезвычайно сложен и зависит от большого числа факторов – социально-экономических, экологических, природно-климатических, которые не всегда поддаются быстрому и объективному анализу. Оценивая пути оптимизации эпидемиологического надзора за хантавирусными инфекциями, следует признать важность практического внедрения информационно-аналитических технологий, позволяющих достоверно оценивать связь значимых эпидемиологических параметров с ландшафтно-географическими характеристиками изучаемых территорий. Использование в целях эпидемиологического надзора за природно-очаговыми инфекциями ГИС-технологии позволяет проводить ретроспективный и оперативный эпидемиологический анализ в режиме реального времени (Б.Л. Черкасский с соавт. 2005), оценивать эпидемическую активность природных очагов, и определять риск инфицирования людей (R.J. Eisen с соавт. 2007; C. Linard с соавт. 2007).

Актуальность проблем, изложенных выше, послужила основанием для проведения данной работы.

Цель работы разработка и адаптация молекулярно-генетических методов и современных компьютерных технологий для усовершенствования научно-теоретических и практических основ эпидемиологического надзора за хантавирусными инфекциями.

Основные задачи исследования.

  1. Провести анализ эпидемических проявлений ГЛПС на территории РФ
    и обосновать необходимость оптимизации эпидемиологического надзора за хантавирусными инфекциями.
  2. Усовершенствовать схемы лабораторно-диагностических и эпизоотологических исследований в системе эпиднадзора за ГЛПС на основе молекулярно-генетических методов.
  3. Разработать и адаптировать молекулярно-генетические методы для индикации и дифференциации вирусов комплекса ГЛПС. Оценить возможности молекулярных технологий (ПЦР-анализа, секвенирования РНК-изолятов) при изучении заболеваемости в очагах ГЛПС.
  4. Провести генотипирование и филогенетический анализ новых хантавирусов, выявить молекулярные маркёры для дифференциации штаммов на уровне подвида. Оценить гетерогенность популяций хантавирусов, формирующих природные очаги инфекции на Европейской части Российской Федерации.
  5. Определить структуру и сформировать информационную базу данных в электронном формате для картографического анализа эпидемиологически значимых параметров с помощью технологии географической информационной системы.
  6. Провести оценку эпидемического потенциала территории и определить степень риска заражения людей ГЛПС с использованием информации о молекулярно-эпидемиологических особенностях циркуляции хантавирусов на основе ГИС-технологии (на модели Липецкой области).
  7. Обосновать роль и значение современных методических подходов и технологий для оптимизации эпидемиологического надзора за ГЛПС.

Научная новизна и теоретическая значимость.

Сформированы основные положения молекулярно-эпидемиологического мониторинга, необходимые для оптимизации эпидемиологического надзора за ГЛПС на современном этапе.

Использование разработанных молекулярно-генетических методик (на основе ПЦР-анализа и секвенирования фрагментов генома) позволило впервые изучить генетическое разнообразие популяций вирусов комплекса ГЛПС и оценить эпидемиологический потенциал природно-очаговых территорий с учётом спектра циркулирующих хантавирусов. Впервые картографический анализ эпидемиологически значимых критериев, выполненный на основе ГИС-технологии с применением математических и статистических методов, позволил объективно провести эпидемиологическое районирование модельной территории по уровню опасности инфицирования ГЛПС.

Показаны возможности использования ПЦР-анализа для решения ряда эпидемиологических задач, связанных с изучением заболеваемости ГЛПС, верификацией клинического диагноза, выявлением основных источников инфекции и определением границ природных очагов хантавирусов. Некоторые теоретические и практические вопросы вирусологии, касающиеся идентификации хантавирусов, определения их таксономической принадлежности, характеристики гетерогенности вирусных популяций, были решены с помощью разработанных молекулярно-генетических методик – ПЦР-анализа и секвенирования выбранных фрагментов генома.

Впервые были сконструированы системы универсальных консенсусных праймеров на основе фрагментов кодирующей части генома хантавирусов – гена нуклеопротеина N (S-сегмента) и гена гликопротеина G2 (М-сегмента); на их основе разработаны ПЦР-методики для выявления широкого спектра штаммов хантавирусов комплекса ГЛПС (Пуумала, Добрава, Хантаан, Сеул, Тула), циркулирующих в природе.

Разработаны принципы генотипирования хантавирусов на основе секвенирования изолятов РНК, выявленных в ПЦР с помощью предложенных универсальных праймеров. Теоретически обоснована и экспериментально подтверждена пригодность выбранных фрагментов генома для их последующего филогенетического анализа.

В пределах, используемых для филогенетического анализа фрагментов аминокислотных последовательностей, обнаружены молекулярные маркёры, позволяющие различать штаммы хантавирусов комплекса ГЛПС из различных регионов РФ.

При проведении молекулярно-генетических исследований полевого и клинического материала, полученного из 9 регионов РФ, установлена высокая эффективность разработанных методик для лабораторной диагностики ГЛПС, в том числе при исследовании природных очагов - для выявления, идентификации и характеристики новых геновариантов хантавирусов. Получены новые данные о генетическом разнообразии и географической распространённости хантавирусов, формирующих природные очаги ГЛПС на территории Российской Федерации. Впервые с помощью молекулярных технологий выявлена циркуляция новых геновариантов вируса Добрава на территории Астраханской области и Республики Калмыкии, ранее считавшейся неэнзоотичной по ГЛПС.

Технологические возможности разработанных методик были продемонстрированы во время изучения вспышечной заболеваемости в Центральном Черноземье - для этиологической расшифровки и установления родства РНК-изолятов вируса Добрава, выявленных от больных ГЛПС и полевых мышей (A.agrarius), основных источников инфекции.

Впервые с использованием количественных вариантов ПЦР в режиме реального времени были получены данные по динамике вирусной нагрузки у больных ГЛПС, инфицированных вирусом Пуумала. Это позволило определить оптимальные сроки, в которые применение ПЦР-анализа для диагностики ГЛПС наиболее целесообразно.

Практическая значимость работы.

Предложена схема усовершенствования эпидемиологического надзора за хантавирусными инфекциями, предусматривающая использование молекулярно-генетических методов и ГИС-технологии. Разработанные методические подходы могут быть использованы в практике работы Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (Роспотребнадзор) с целью оптимизации прогнозирования и профилактики заболеваемости ГЛПС.

Показано, что включение молекулярно-генетического компонента в систему эпиднадзора обеспечивает: возможность верификации диагноза в ранние сроки заболевания, быструю дифференциацию возбудителя до вида и оценку уровня отличий новых вирусных РНК-изолятов от выявленных ранее штаммов хантавирусов, идентификацию места (области, региона), где произошло инфицирование человека ГЛПС, а также возможность более точной оценки эпидемического потенциала природных очагов хантавирусов.

Сконструированы диагностические тест-системы на основе ПЦР, позволяющие осуществлять прямую детекцию и дифференциацию хантавирусов в полевом и клиническом материале, а также оценивать количество вирусных частиц в исследуемых пробах.

Для анализа эпидемических проявлений хантавирусных инфекций на территории Липецкой области была сформирована электронная база данных в формате, совместимом с программой ГИС «КОМПАС» (разработанной в ГУ Институте проблем передачи информации РАН, Москва). База данных «ГЛПС в Липецкой области», включающая эпидемиологически значимую информацию, необходимую для определения эпидемического потенциала исследованных территорий и оценки риска заражения людей, используется на практике в работе региональных Управлений Роспотребнадзора.

Внедрение полученных результатов.

• ПЦР-тест-система «АмплиСенс Хантавир» для детекции хантавирусов Пуумала, Добрава, Тула, Сеул, Хантаан разработана и передана вместе с необходимой нормативно-технической документацией на производство ЦНИИ эпидемиологии.

• Депонированы в Международный компьютерный банк данных GenBank 226 фрагментов нуклеотидных последовательностей М- и S- сегментов геномов хантавирусов Добрава, Пуумала и Тула, выявленных на территории Российской Федерации в 2003-2008 гг. Нуклеотидные последовательности зарегистрированы в базе данных GenBank под следующими номерами - DQ064647-064689; DQ061255-DQ061272, EU549802-549815, EU562892-563018, EU652420 - EU652443.

• Разработанный алгоритм программы ГИС «КОМПАС» для картографического анализа эпидемиологически значимых критериев вместе с приложением - электронной базой данных «ГЛПС в Липецкой области» используется в работе ФГУЗ Роспотребнадзора «Центр гигиены и эпидемиологии в Липецкой области».

• Методические указания «Организация молекулярно-генетических исследований биологического материала из природных очагов ГЛПС» утверждены Федеральной службой по надзору в сфере защиты прав потребителей и благополучия человека РФ.

Материалы диссертации используются при чтении лекций на кафедре эпидемиологии ГОУ ДПО «Российская медицинская академия последипломного образования» Росздрава.

Апробация работы. Материалы диссертационной работы были представлены:

  • на Всероссийской научно-практической конференции «Генодиагностика инфекционных заболеваний» (Москва, 2002);
  • на Всероссийской научно-практической конференции «Генодиагностика инфекционных болезней» (Москва, 2004);
  • на научно-практической конференции «Генодиагностика инфекционных болезней» (Новосибирск, 2005);
  • на Международной конференции по инфекционным болезням (ICEID) (Атланта, США, 2006 г.);
  • на Международной научно-практической конференции «Геномные технологии в медицине и медицинское образование на рубеже веков» (Алматы, 2006);
  • на научно-практической конференции «Арбовирусы и арбовирусные инфекции» (Астрахань, 2006);
  • на Всероссийском научно-практическом съезде общества эпидемиологов, микробиологов и паразитологов (Москва, 2007);
  • на Международной научно-практической конференции «Молекулярная диагностика инфекционных болезней» (Минск, 2007);
  • на Всероссийской научно-практической конференции «Организация противоэпидемических мероприятий по профилактике геморрагической лихорадке с почечным синдромом» (Оренбург, 2007);
  • на межрегиональной научно-практической конференции «Состояние здоровья населения центрального федерального округа» (Липецк, 2007);
  • на Международной конференции по зоонозным инфекциям - «Emerging Zoonoses», (Лимассол, Кипр, 2007);
  • на Всероссийской научно-практической конференции «Молекулярная диагностика-2007» (Москва, 2007).

Апробация диссертационной работы состоялась на Учёном совете ФГУН «Центральный НИИ эпидемиологии» Роспотребнадзора 15 октября 2008 года.

Публикации. Основные положения диссертации отражены в 36 опубликованных научных работах, в том числе 9 статей опубликованы в изданиях, рекомендованных ВАК Российской Федерации.

Объем и структура диссертации. Диссертация состоит из введения, обзора литературы, 8 глав собственных исследований, выводов, списка использованной литературы, включающего 277 зарубежных и 55 отечественных источников. Общий объем работы составляет 239 страниц компьютерного текста, иллюстрированного 27 таблицами и 51 рисунком.


СОБСТВЕННЫЕ ИССЛЕДОВАНИЯ

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЙ

Материалы. Для анализа эпидемических проявлений ГЛПС на территории России использовалась государственная статистическая отчётность Роспотребнадзора.

Для выполнения поставленных в ходе настоящей работы задач использовался полевой и клинический материал, исследование которого проводилось с помощью молекулярно-генетических и иммуносерологических методов (табл. 1). Методом ПЦР было исследовано 1728 проб (848 – от людей и 880 от грызунов), из которых 272 пробы были секвенированы. В ходе работы были использованы результаты иммунологических исследований 6435 образцов (5879 проб от мелких млекопитающих исследованы в ИФА; 482 пробы от людей и 74 от грызунов – в НМФА), из них 301 проба была серотипирована.

Исследование биологического материала иммуносерологическими методами проводили на базе федеральных государственных учреждений здравоохранения «Центров гигиены и эпидемиологии» РФ. Серотипирование сывороток крови от больных людей и проб от грызунов осуществлялось сотрудниками ФГУП ИПВЭ им. М.П.Чумакова РАМН на базе лаборатории геморрагических лихорадок.



Таблица 1.

Биологический материал, исследованный с помощью молекулярно-генетических и иммуносерологических методов

Регион исследования (период) Вид материала Лабораторные методы исследования
ПЦР ИФА НМФА Секвениро- вание Серотипи- рование
Астраханская область, (2004-2005) Суспензии органов ММ* 389 74 74 (МФА) 18 4
Кровь от больных с различными диагнозами и доноров 200 н.и.** н.и. н.и. н.и.
Республика Башкортостан (2005) Кровь от больных ГЛПС 50*** н.и. 5 5 н.и.
Самарская область (2003) Суспензии органов ММ 190 190 н.и. 10 н.и.
Липецкая область (2002-2008) Суспензии органов ММ 163 5477 н.и. 61 32
Кровь от больных с диагнозом ГЛПС 15 н.и. 335 9 265
Воронежская область (2006-2007) Суспензии органов ММ 40 40 н.и. 38 н.и
Кровь от больных с диагнозом ГЛПС 21 н.и 21 3 н.и
Оренбургская область (2006-2007) Суспензии органов ММ 33 33 н.и. 11 н.и.
Кровь от больных с диагнозом ГЛПС 42 н.и. 42 13 н.и.
Курская область (2007-2008) Суспензии органов ММ 26 26 н.и. 15 н.и.
Кровь от больных с диагнозом ГЛПС 2 н.и 2 2 н.и
Тамбовская область (2007) Суспензии органов ММ 11 11 н.и. 6 н.и.
Тюменская область (2006) Суспензии органов ММ 18 18 н.и. 18 н.и.
Омская область (2005) Суспензии органов ММ 10 10 н.и. 10 н.и.
Удмуртская Республика (2003-2005) Кровь от больных с диагнозом ГЛПС 30 н.и. 30 6 н.и.
Кровь от больных ГЛПС 470*** н.и. 47 47 н.и.
Итого за 2002-2008 гг. Образцов крови от людей 848 - 482 85 265
Образцов суспензий органов ММ 880 5879 74 187 36

ММ* - мелкие млекопитающие

н.и.** - не исследовали

*** - образцы крови от больных ГЛПС взяты в динамике (10-кратно от каждого пациента)


Методы исследований. В работе были использованы эпидемиологические, молекулярно-генетические, иммуносерологические, вирусологические методы, а также методы статистического анализа.

Основой методологии нашего исследования был комплексный эпидемиологический подход, включающий эпизоотологическое и эпидемиологическое обследование природных и эпидемических очагов ГЛПС, молекулярно-генетическую характеристику выявленных изолятов хантавирусов, а также анализ полученных данных с помощью современных компьютерных программ и ГИС-технологии.

В работе использовали информационно-аналитическую систему «COMPASS» http://www.geo.iitp.ru, разработанную Институтом проблем передачи информации РАН (ИППИ РАН). Система «КОМПАС» реализована в виде программы на языке Java 1.5. Объектами анализа служили районы Липецкой области (картографические данные) и связанные с ними атрибутивные данные (эпидемиологические показатели). Информационная база данных «ГЛПС в Липецкой области» была сформирована в формате таблиц Microsoft Excel, в которые включены предварительно отобранные для анализа показатели. Перед началом работы в системе «КОМПАС» таблицы данных были преобразованы в формат базы данных – dbf, кроме этого были созданы дополнительные конфигурационные файлы, содержащие алгоритмы для работы с данными и их анализа.

Для проведения молекулярно-генетических исследований (экстракции РНК, обратной транскрипции, ПЦР-анализа и других этапов исследования) использовали отдельные реактивы и коммерческие наборы производства «АмплиСенсТМ» (ФГУН ЦНИИ эпидемиологии).

Тотальную РНК из легочных суспензий и цельной крови выделяли по модифицированному методу Хомчинского, используя для этого компоненты коммерческих наборов «РИБО-золь-В» и «РИБО-сорб» (производство ФГУН ЦНИИ эпидемиологии). РНК из плазмы крови больных ГЛПС и культуральной (вируссодержащей) жидкости выделяли методом нуклеосорбции в присутствии гуанидинтиоцианата, используя набор «РИБО-сорб». Обратную транскрипцию проводили со случайными праймерами с использованием набора «Реверта-L» (производство ФГУН ЦНИИ эпидемиологии). Для постановки ПЦР и секвенирования изолятов РНК использовались наборы специфичных и универсальных праймеров, разработанных в ходе настоящей работы. Для выбора праймеров и зондов использовали программы Oligo 330, Primer Premier 5, Vector NTI 9, ресурсы интернета и веб-сайты - http://www.eu.idtdna.com, http://frontend.bioinfo.rpi.edu и http://www.ncbi.nlm.nih.gov (BLAST, GenBank).

Выявление специфического антигена в материале от мелких млекопитающих осуществляли с использованием коммерческой диагностической тест-системы "Хантагност" (производство ФГУП ПИПВЭ им. М.П. Чумакова РАМН). Выявление специфических антител класса М и G у больных ГЛПС осуществляли с помощью непрямого метода флюоресцирующих антител, используя для этой цели коммерческую тест-систему «Культуральный поливалентный диагностикум ГЛПС для непрямого МФА» (производство ФГУП ПИПВЭ им. М.П.Чумакова РАМН).


ОСНОВНЫЕ ЭПИДЕМИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ГЛПС

В РОССИЙСКОЙ ФЕДЕРАЦИИ

Ежегодно на территории РФ регистрируется 5-7 тысяч случаев ГЛПС; средний многолетний показатель заболеваемости (за 1995-2007 гг.) составляет 5,35 на 100 тысяч населения, уровень летальности - 0,5 %. Наибольшая заболеваемость отмечалась в 1997 год, когда число заболевших достигало более 20000 человек (14,3 на 100 тыс.).

При анализе динамики ГЛПС в РФ становится очевидным отсутствие тенденции к снижению уровня заболеваемости, а также существование циклических подъёмов на фоне ежегодно регистрируемых случаев этой инфекции (рис. 1).

Наиболее активные природные очаги ГЛПС располагаются в лесной ландшафтной зоне в умеренных широтах Европейской части РФ (территория Приволжского федерального округа - ПФО), где ежегодные показатели заболеваемости составляют от 8 до 67 (в среднем - 32) на 100 тысяч населения.

Рисунок 1. Динамика заболеваемости ГЛПС в Российской Федерации.

Заболеваемость в субъектах ПФО ассоциирована преимущественно с хантавирусом Пуумала, основным резервуаром которого является рыжая полевка. Оптимум ареала этого вида, приуроченный к широколиственным и смешанным лесам умеренной зоны, территориально совпадает с расположением крупных населенных пунктов, что значительно увеличивает риск заражения людей и уровень заболеваемости в целом. За период с 1996 по 2006 гг. по сравнению с предыдущим 10-летием (с 1985 по 1995 гг.) заболеваемость в субъектах этого округа возросла в 1,5 раза. В этот период было зарегистрировано около 82000 случаев, что составляло почти 90% от общего числа случаев зарегистрированных в Российской Федерации.

В настоящее время второе место по заболеваемости занимает Центральный федеральный округ, при этом случаи ГЛПС регистрируются во всех 18 административных областях. За период с 1996 по 2006 гг. в регионах этого округа было зарегистрировано 4237 случаев, заболеваемость по сравнению с предыдущим десятилетием возросла почти в 2 раза. Обращает внимание тот факт, что в период с 1998 по 2004 гг. добавилось 5 новых субъектов (Курская, Брянская, Липецкая, Тамбовская и Белгородская области), входящих в ЦФО, в которых стали регулярно регистрироваться случаи ГЛПС, в том числе в виде вспышек.

Помимо заболеваемости, связанной с вирусом Пуумала, в Центральном федеральном округе наиболее часто регистрируются случаи ГЛПС, ассоциированные с вирусом Добрава. При этом зарегистрированные в последние годы резкие подъёмы заболеваемости в ряде областей были вызваны преимущественно этим вирусом.

Анализ заболеваемости ГЛПС в Уральском, Северо-Западном, Сибирском и Дальневосточном федеральных округах показал, что за период с 1996 по 2006 гг. по сравнению с предыдущим десятилетием число заболевших и показатель заболеваемости на 100 тысяч практически не изменились.

Проведенный статистический анализ динамики заболеваемости за последние восемь лет (1999 – 2007 гг.) не позволил выявить тенденцию к её снижению в большинстве федеральных округов и в РФ, в целом. Установлено, что динамика заболеваемости в ЦФО существенно отличается от таковой в других округах в связи с тем, что её рост стал наблюдаться только в последние годы.

Осуществление эпиднадзора за ГЛПС в современных условиях можно представить как комплекс мероприятий, разработанных в соответствии с иерархическими уровнями эпидемического процесса (В.Б. Коротков с соавт. 1996). Мониторинг за эпидемическим процессом включает регистрацию всех лабораторно подтверждённых с помощью серологических методов случаев ГЛПС, описание клинических форм инфекции, изучение иммунологической структуры населения, включая группы риска.

Слежение за эпизоотическим процессом является неотъемлемым компонентом эпиднадзора за ГЛПС. Параметры эпизоотического процесса включают данные о составе и численности основных носителей хантавирусов, их инфицированности. Традиционно используемые в эпизоотологических исследованиях иммунологические методы (ИФА) позволяют за короткий промежуток времени провести массовый скрининг популяций мелких млекопитающих на наличие хантавирусного антигена и оценить уровень их инфицированности. На основе данных эпидемиолого-эпизоотологического надзора прогнозируется заболеваемость, оценивается эпидобстановка, принимаются управленческие решения о проведении противоэпидемических мероприятий, оценивается эффективность профилактических мероприятий.

Очевидно, что неспецифическую профилактику, которая сводится преимущественно к мерам по сокращению численности диких грызунов в ходе осуществления широкомасштабных дератизационных мероприятий в конкретных природных очагах ГЛПС, следует проводить на основе информации о циркулирующих там типах хантавирусов, вызывающих заболевания у людей. Известно, например, что заражения, связанные с вирусом Пуумала, происходят преимущественно в летне-осенний период (июль-октябрь), тогда как случаи ГЛПС, ассоциированные с вирусом Добрава, отмечаются главным образом в зимний период (декабрь-февраль). Прежде всего, эти различия обусловлены биологическими особенностями (циклами размножения) рыжей полёвки и полевой мыши, являющимися основными носителями вирусов Пуумала и Добрава на территории России.

Широко применяемые в системе эпиднадзора иммуносерологические исследования не позволяют определить спектр циркулирующих в природных очагах хантавирусов, определить перечень основных носителей, являющихся главными источниками инфицирования людей. В настоящее время информация о разнообразии и таксономической принадлежности хантавирусов, являющихся потенциальными возбудителями ГЛПС, для большинства административных регионов РФ отсутствует. Дератизационные мероприятия в природных очагах, как правило, проводятся по единой схеме, без учёта популяционных особенностей и биологических циклов носителей хантавирусов, что значительно снижает их эффективность.

Очевидно, что сохраняющаяся напряжённая эпидобстановка по заболеваемости ГЛПС требует улучшения системы эпидемиологического надзора, что предусматривает, в частности, совершенствование информационно-аналитического компонента, в том числе оптимизации схемы лабораторной диагностики хантавирусных инфекций.

РАЗРАБОТКА МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ МЕТОДОВ ДЛЯ ОПТИМИЗАЦИИ ЛАБОРАТОРНОЙ ДИАГНОСТИКИ ГЛПС

Существующая схема дифференциации видовой принадлежности хантавирусов на основе традиционных иммуносерологических и вирусологических методов является сложной, трудоёмкой и малоэффективной. С учётом установленной взаимосвязи тяжести заболевания ГЛПС у людей и инфицированием определённым серо-(гено) типом хантавирусов, идентификация инфекционного агента заболевания представляет определённую эпидемиологическую значимость. Молекулярно-генетические методы являются существенным подспорьем при проведении таких исследований.

В связи с отсутствием на отечественном рынке, как коммерческих тест-систем, так и стандартизованных ПЦР-методик, актуальной являлась задача по разработке диагностических наборов для детекции и идентификации хантавирусов.

В ходе работы были сконструированы системы видоспецифичных и универсальных (группоспецифичных) праймеров для детекции широкого спектра штаммов хантавирусов комплекса ГЛПС – Пуумала, Добрава, Хантаан, Сеул и Тула (табл. 2). Кроме того, сконструированы количественные варианты ПЦР в режиме реального времени с зондами специфичными к вирусам Добрава и Пуумала (табл. 2), позволяющие оценивать количество вирусных копий в исследуемых биологических образцах.

Системы универсальных праймеров были сконструированы на основе кодирующей части генома – гена нуклеопротеина N (S-сегмент) и гена гликопротеина G2 (М-сегмент). Праймеры, расположенные в области двух различных локусов генома, были выбраны с целью повышения эффективности исследований, направленных на выявление как можно большего спектра вирусов комплекса ГЛПС, циркулирующих в природе, а также на обнаружение существующих в природе хантавирусов с возможной генетической вариабельностью в области выбранных мишеней. Системы видоспецифичных праймеров были разработаны на основе кодирующей области S-сегмента генома для дифференциации в ПЦР хантавирусов, наиболее широко распространённых на Европейской части РФ - Пуумала, Тула и Добрава (табл. 2).

Таблица 2.

Разработанные системы олигонуклеотидных праймеров и зондов для детекции и идентификации хантавирусов комплекса ГЛПС


Название
Последовательность 5-3 Позиции генома Штамм, (сегмент)
Универсальные праймеры для детекции в ПЦР вирусов комплекса ГЛПС (Пуумала, Добрава, Хантаан, Сеул, Тула)
Hant-new (+) TT(C/T)AA(G/A)GATGACA(C/G)(A/T/C)TC(A/T/G)TTTGAGG (517-541) Baskiria AF442613 (S)
Hant-mod (+) AA(G/A)GATGACA(C/G)(A/T/C)TC(A/T/G)TTTGAGGAT (520-543)
Hant-kom (+) TT(C/T)AA(G/A)GATGACA(C/G)(A/T/C)TC(A/T/G)TTTGAGGAT (517-543)
Hant-R (-) C(T/A/G)GGTGC(A/T/C)C(A/C)(A/T/G)GCAAA(T/G/A)ACCCA (991-970)
DobrM-F (+) ATCAATAGAAGGTGCATGGGGТTCTG 2971-2996 SK/Aa AY961616 (М)
DobrM-alter (+) CAATAGAAGGTGCATGGGGTTCTG 2973-2996
DobrM-R (-) CCACATTGAGGTGCACCATCATCATA 3297-3272
Специфичные праймеры для идентификации в ПЦР вирусов Пуумала, Добрава и Тула
Tulа_S/F (+) AAGTACACTACAGAGCAGACGGGC 123-146 AF442621, (S)
Puum_S/F (+) TACAAGAGAAGAATGGCAGATGCTG 181-205 Baskiria AF442613 (S)
Pum/Tul/R (-) TCAATGGCATTCACATCAAGGAC 323-301
inPUV_S/F (+) CCCAGTCCACCATGAAAGCTGAAG 551-574
inPUV_S/R (-) CTGTGCTGGTGTCCCTGGTTTAAC 774-751
DOBV_S/F (+) AAGCTACTATCCGAGCCATCTCCAAC 768-793 Kurkino/98 AJ131673, (S)
DOBV_S/R (-) GCAAAGACCCAGATTGATGATGGTGA 961-936
Зонды для идентификации вирусов Пуумала и Добрава в ПЦР РРВ
PUM_S-Z JOE-ACTCCCATTACTGGACTCATGATGTTACGGGAGTG- BQH-1 666-637 Baskiria AF442613, (S)
DBR_M-Z FAM-TGTGCACCATAACAGATGGCCATATCACATGCTGCAC-BQH1 3096-3065 Saaremaa AJ009774 (М)

Диагностическая эффективность разработанных методик (одностадийной ПЦР и «Nested»-ПЦР) оценивалась при исследовании клинического материала от больных. В исследование было включено 40 пациентов с предварительным клиническим диагнозом ГЛПС, поступивших в стационар в ранние сроки болезни (не позднее 4-го дня). Материал для анализа в ПЦР забирался у каждого больного в динамике (всего 10 раз) - в день поступления пациента в больницу, а затем через определенные интервалы до 17 дня болезни включительно (табл. 3). Для выявления сероконверсии анализ антител методом НМФА проводили дважды – в день поступления больного в стационар и через 2 недели повторно.

Таблица 3.

Оценка диагностической эффективности ПЦР и НМФА у больных ГЛПС в динамике

День болезни Положительные результаты в одностадийной ПЦР число (%) Положительные результаты в Nested ПЦР число (%) Положительные результаты в НМФА число (%)
4 39 (97,5) 40 (100) 32 (80)
6 37 (92,5) 40 (100) н.и.*
7 34 (85) 39 (97,5) н.и.
8 32 (80) 36 (90) н.и.
9 28 (70) 31 (77,5) н.и.
10 21 (52,5) 31 (77,5) н.и.
11 19 (47,5) 29 (72,5) н.и.
13 18 (45) 23 (57,5) н.и.
15 14 (35) 17 (42,5) н.и.
17 8 (20) 14 (35) 40 (100)

н.и.* - не исследовали

В результате исследования клинического материала в первый день госпитализации хантавирусная РНК была выявлена методом «Nested» ПЦР у всех 40 больных ГЛПС (100%), в одностадийной ПЦР - у 39 из 40 больных (в 97,5%). Из полученных результатов, очевидно, что с высокой эффективностью (не менее 70%) можно выявлять РНК вируса в плазме крови у больных ГЛПС до 11-го дня болезни с помощью «Nested» ПЦР и до 9-го дня при использовании однораундовой ПЦР. С помощью НМФА антитела выявлялись у 32 (80%) больных в титрах (от 1/32 до 1/256) в день поступления в стационар. При повторном исследовании сывороток через 14 дней антитела были выявлены у 40 (100%) больных в титрах (от 1/64 до 1/8000). Несмотря на высокую чувствительность НМФА необходимость учета результатов по 4-х кратному нарастанию титров до некоторой степени ограничивает возможности данной методики для ранней диагностики ГЛПС.

Вирусная нагрузка при ГЛПС оценивалась в результате исследования с помощью ПЦР в режиме реального времени (ПЦР РРВ) и «Nested» ПЦР 120 образцов плазмы крови от 12 больных в динамике с 4 по 17 день болезни.

С помощью ПЦР РРВ было установлено, что на 4 день болезни у больных в крови присутствует РНК вируса в концентрациях от 4х104 до 1х106 копий/мл (табл. 4). За время наблюдения, то есть за 14 дней нахождения пациентов в стационаре, было выявлено постепенное снижение вирусной нагрузки в крови больных в 10-200 раз, в среднем – в 65 раз. Сравнимые результаты по чувствительности и динамике вирусной нагрузке были получены в «Nested» ПЦР при исследовании десятикратных разведений кДНК. Титры у большинства больных постепенно снижались с 1/1000 (4 день) до 1/10 (на 13-17 день); в среднем в 77 раз.

Таблица 4.

Оценка диагностической чувствительности ПЦР-методик и определение вирусной нагрузки у больных ГЛПС на основе ПЦР РРВ

День болезни Положительные результаты в ПЦР РРВ число (%) Положительные результаты в Nested ПЦР число (%) Средняя вирусная нагрузка копий/мл* Вирусная нагрузка max-min копий/мл**
4 12 (100) 12 (100) 410000 1118000-39000
6 12 (100) 12 (100) 147000 615000-5900
7 12 (100) 12 (100) 63000 382000-5000
8 12 (100) 12 (100) 27000 133000-3700
9 9 (75) 11 (91) 28000 231000-4000
10 9 (75) 11 (91) 8800 46000-6000
11 5 (42) 7 (58) 7200 85000-6700
13 5 (42) 6 (50) 14000 119000-4000
15 5 (42) 5 (42) 7200 56000-2600
17 4 (33) 4 (33) 2300 19600-2700


Pages:   || 2 |
 
Похожие работы:

«ТАБАЛЕНКОВА Галина Николаевна ПРОДУКТИВНОСТЬ СЕЛЬСКОХОЗЯЙСТВЕННЫХ КУЛЬТУР В ПОДЗОНЕ СРЕДНЕЙ ТАЙГИ ЕВРОПЕЙСКОГО СЕВЕРО-ВОСТОКА РОССИИ 03.00.12 – физиология и биохимия растений АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Москва 2007 Работа выполнена в лаборатории экологической физиологии растений Института биологии Коми научного центра Уральского отделения Российской академии наук Научный консультант : доктор биологических наук, профессор...»

«Конькова Марина Сергеевна ВНЕКЛЕТОЧНАЯ ДНК – ФАКТОР СИГНАЛИЗАЦИИ ПРИ РАДИАЦИОННОМ ЭФФЕКТЕ СВИДЕТЕЛЯ 03.02.07 – Генетика АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2011 Работа выполнена в лаборатории молекулярной биологии Учреждения Российской академии медицинских наук Медико-генетического научного центра РАМН Научный руководитель: доктор биологических наук, Вейко Наталья Николаевна Официальные оппоненты: доктор...»

«Голощапов Владимир Борисович Морфофункциональные особенности щитовидной железы, надпочечников и яичников у ремонтных свинок в пер иод становления половой функции 03.00.13 – физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук БЕЛГОРОД – 2008 Работа выполнена на кафедре терапии и акушерства ФГОУ ВПО Курская государственная сельскохозяйственная академия имени профессора И.И. Иванова Научный руководитель: заслуженный ветеринарный врач РФ,...»

«Глухенький Илья Юрьевич СОВЕРШЕНСТВОВАНИЕ СИСТЕМЫ ПРОГНОЗИРОВАНИЯ П О СЛЕДСТВИЙ АВАРИЙНЫХ РАЗЛИВОВ НЕФТИ В ПРИБРЕЖНОЙ ЗОНЕ КЕРЧЕНСКОГО ПРОЛИВА Специальность 03.02.08 – Экология (в нефтегазовой отрасли) (технические науки) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата технических наук Краснодар – 2012 Работа выполнена в ФГБОУ ВПО Кубанский государственный технологический университет Научный руководитель: кандидат химических наук, доцент Попова Галина Георгиевна...»

«Выдержки из некоторых отзывов, присланных на автореферат диссертационной работы Савченко Александра Петровича Миграции наземных позвоночных Центральной Сибири и проблемы экологической безопасности, представленной на соискание ученой степени доктора биологических наук по специальности 03.00.16 – экология Внимательное ознакомление с авторефератом диссертации Александра Петровича Савченко “Миграции наземных позвоночных Центральной Сибири и проблемы экологической безопасности”, представленной на...»

«Неминущая Лариса Анатольевна ТЕХНОЛОГИЯ ПРОИЗВОДСТВА И ОБЕСПЕЧЕНИЕ КАЧЕСТВА СИНБИОТИКОВ ЛАКТОСУБТИЛ-ФОРТЕ И АВИЛАКТ-ФОРТЕ, ЭФФЕКТИВНОСТЬ ИХ ПРИМЕНЕНИЯ В ПТИЦЕВОДСТВЕ 03.00.06 – биотехнология (в том числе бионанотехнологии) АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Щелково – 2011 г. Работа выполнена в ГНУ Всероссийский научно-исследовательский и технологический институт биологической промышленности Российской академии сельскохозяйственных...»

«Нужнова Ольга Камильевна ЭКОЛОГИЧЕСКИЙ АНАЛИЗ ВЗАИМООТНОШЕНИЙ НАСЕКОМЫХ-ОПЫЛИТЕЛЕЙ С РАСТЕНИЯМИ В УСЛОВИЯХ ШИРОТНОГО ГРАДИЕНТА (НА ПРИМЕРЕ БРЮКВЕННИЦЫ PIERIS NAPI L.) 03.02.08 - экология 03.02.01 - ботаника Автореферат диссертации на соискание учёной степени кандидата биологических наук...»

«Правдивцева Мария Ивановна Характеристика биологической активности экзополисахаридов бактерий рода Lactobacillus и перспективы их использования 03.02.03 – микробиология АВТОРЕФЕРАТ на соискание ученой степени кандидата биологических наук Саратов – 2012 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования Саратовский государственный аграрный университет им. Н.И. Вавилова Научный руководитель: доктор...»

«Водолеев Анатолий Сергеевич РЕКУЛЬТИВАЦИЯ ТЕХНОГЕННО НАРУШЕННЫХ ЗЕМЕЛЬ ЮЖНОГО КУЗБАССА С ИСПОЛЬЗОВАНИЕМ НЕТРАДИЦИОННЫХ МЕ­ЛИОРАНТОВ Специальности: 06.01.02.– Мелиорация, рекультивация и охрана земель; 03.00.16 - Экология Автореферат диссертации на соискание ученой степени доктора сельскохозяйственных наук Барнаул – 2007 Работа выполнена на кафедре ботаники ГОУ ВПО Кузбасская государственная педагогическая академия Официальные оппоненты: доктор биологических наук, профессор...»

«ФЕОКТИСТОВА Наталья Юрьевна АДАПТИВНЫЕ КОМПЛЕКСЫ И ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ В П/СЕМ. CRICETINAE, НА ПРИМЕРЕ ХОМЯЧКОВ РОДА PHODOPUS 03.00.08 – зоология Автореферат диссертации на соискание ученой степени доктора биологических наук Москва 2008 Работа выполнена в Институте проблем экологии и эволюции им. А.Н. Северцова РАН Научный консультант : доктор биологических наук Чернова Ольга Федоровна Официальные оппоненты : доктор биологических наук, профессор, Жигарев Игорь...»

«Ульянов Александр Юрьевич СОВЕРШЕНСТВОВАНИЕ ПРОИЗВОДСТВА ВАКЦИНЫ ХОЛЕРНОЙ БИВАЛЕНТНОЙ ХИМИЧЕСКОЙ ТАБЛЕТИРОВАННОЙ 03.01.06 – биотехнология (в том числе бионанотехнологии) 03.02.03 – микробиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Саратов - 2011 Работа выполнена в Федеральном государственном учреждении здравоохранения Российский научно-исследовательский противочумный институт Микроб Федеральной службы по надзору в сфере защиты прав...»

«Волков Игорь Вячеславович БИОМОРФОЛОГИЧЕСКИЕ АДАПТАЦИИ ВЫСОКОГОРНЫХ РАСТЕНИЙ 03.00.16 – Экология АВТОРЕФЕРАТ диссертации на соискание степени доктора биологических наук Новосибирск – 2008 Работа выполнена в Томском государственном педагогическом университете. Научный консультант – доктор биологических наук Долгин Владимир Николаевич. Официальные оппоненты: доктор биологических наук, с.н.с. Байкова Елена Валентиновна; доктор биологических наук, профессор Гуреева Ирина...»

«Полешко Андрей Сергеевич ИЗУЧЕНИЕ МЕХАНИЗМОВ ЭПИГЕНЕТИЧЕСКОЙ РЕГУЛЯЦИИ ЭКСПРЕССИИ ГЕНОВ НА МОДЕЛИ ВИРУСА САРКОМЫ ПТИЦ 03.00.04 – биохимия 03.00.03 – молекулярная биология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Новосибирск – 2008 Работа выполнена в ГОУ ВПО Новосибирский государственный университет Научный руководитель доктор медицинских наук, профессор Покровский Андрей Георгиевич Официальные оппоненты: доктор биологических наук,...»

«АЗАРИН КИРИЛЛ ВИТАЛЬЕВИЧ эколого-генетическая оценка защитного эффекта аллантоина и мочевой кислоты в условиях окислительного стресса 03.00.16 – экология 03.00.15 – генетика АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Ростов-на-Дону 2009 Работа выполнена на кафедре генетики и в НИИ Биологии Южного федерального университета Научные руководители: доктор...»

«Усубова Екатерина Зиядхановна АККУМУЛЯЦИЯ СЕЛЕНА И ЕГО ВЛИЯНИЕ НА ЭПИФИТНУЮ МИКРОФЛОРУ И ПРОДУКТИВНОСТЬ ФАСОЛИ Специальность 03.02.08 – экология (биология) АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Красноярск – 2012 Работа выполнена на кафедре химической технологии древесины и биотехнологии, кафедре физики в ФГБОУ ВПО Сибирский государственный технологический университет и лаборатории управления биосинтезом фототрофов Института биофизики...»

«ПОЛЯНСКАЯ Татьяна Аркадьевна СТРУКТУРА ЦЕНОПОПУЛЯЦИЙ РАСТЕНИЙ БОРЕАЛЬНОЙ ЭКОЛОГО-ЦЕНОТИЧЕСКОЙ ГРУППЫ ЛЕСНОЙ ЗОНЫ ЕВРОПЕЙСКОЙ РОССИИ 03.02.01 – ботаника 03.02.08 – экология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Казань, 2013 Работа выполнена на кафедре экологии Государственного бюджетного образовательного учреждения высшего профессионального образования Марийский государственный университет Научный консультант: заслуженный деятель науки...»

«БЕСПАЛОВА Татьяна Леонидовна ЭКОЛОГИЧЕСКИ БЕЗОПАСНОЕ ПРИРОДОПОЛЬЗОВАНИЕ НА ОСОБО ОХРАНЯЕМОЙ ПРИРОДНОЙ ТЕРРИТОРИИ (НА ПРИМЕРЕ ПРИРОДНОГО ПАРКА КОНДИНСКИЕ ОЗЕРА) 03.02.08 – экология (биология) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Омск – 2012 Работа выполнена в БУ ХМАО-Югры Природный парк Кондинские озера и в ФГБОУ ВПО Тюменский государственный университет Научный руководитель: доктор биологических наук, профессор Гашев Сергей...»

«Коротков Юрий Степанович ЭКОЛОГИЯ ТАЕЖНОГО КЛЕЩА ( Ixodes persulcatus schulze, 1930 ) В УСЛОВИЯХ ИЗМЕНЕНИЯ КЛИМАТА ЕВРАЗИИ 03.00.19 - паразитология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук МОСКВА – 2009 Работа выполнена в Учреждении Российской академии наук Институт полиомиелита и вирусных энцефалитов им. М.П. Чумакова...»

«Сорокин Андрей Павлович ОСОБЕННОСТИ ПРОСТРАНСТВЕННОЙ ВАРИАБЕЛЬНОСТИ ПОЧВЕННЫХ СВОЙСТВ В ЛАНДШАФТАХ ДЕЛЬТЫ ВОЛГИ Специальность 03.00.27 – почвоведение АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Астрахань 2009 Работа выполнена на кафедре почвоведения аграрного факультета Астраханского государственного университета Научный руководитель: Федотова Анна Владиславовна, доктор биологических наук, доцент Официальные оппоненты: Рулев Александр...»

«Герасименко Вадим Владимирович Обмен веществ и продуктивные качества гусей при использовании пробиот и ков 03.00.13 – физиология 03.00.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Боровск – 2008 Диссертационная работа выполнена в ГНУ Всероссийский научно-исследовательский институт физиологии, биохимии и питания сельскохозяйственных животных и ФГОУ ВПО Оренбургский государственный аграрный университет Научные консультанты –...»








 
2014 www.avtoreferat.seluk.ru - «Бесплатная электронная библиотека - Авторефераты диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.